Zum Inhalt springen
  1. Alle Produkte
  2. VP72-K Forward Primer (King) - 9x 250 nmol (Lyophilized)
  3. Alle Produkte
Preisliste: Price List Default - EUR Preisliste
Preisliste: Price List Default - EUR Preisliste
VP72-K Forward Primer (King) - 9x 250 nmol (Lyophilized)

VP72-K Forward Primer (King) - 9x 250 nmol (Lyophilized)

(0 Rezension)

Sequence (5' to 3'):
CTGCTCATGGTATCAATCTTATCGA

PCR PCR reagent
0,00 € 0,00 € (exkl. Steuern)

In den Warenkorb
Jetzt kaufen
Allgemeine Geschäftsbedingungen
30-Tage-Geld-zurück-Garantie
Versand: 2-3 Geschäftstage
Contact Us

Sequence (5' to 3'):

CTGCTCATGGTATCAATCTTATCGA